28. When doing PCR to amplify a DNA fragment using mouse genomic DNA as the template, which of the following primer pair is the best choice? Forward primers: i. ACGTCTGCCAGGCTG, 15bp, GC content=67%, Tm=57℃ ii. AGCTTGGGTTAATGCCAGGC, 20bp, GC content-55%, Tm=60℃ iii. AGCCCCATTGCTATAAGGGGAG, 22bp, GC content=55%, Tm=59℃Reverse primers: x. CCGTGCCAGGCAGACACGATATAA, 24bp, GC content=54%,Tm=61℃ y.AAGGCGTCAAAGTCTAAAGCG, 21bp, GC content=48%, Tm=59℃ (A) iand x (B) ii and x (C) ii and y (D) iii and x (E) jii and y