44. Which one is true of micronutrients in plants?
(A) Overdoses of them can not be toxic.
(B) They generally help in catalytic functions in the plants.
(C) They are not required for a plant to grow from seed.
(D) They are essential elements of small size and molecular weight.
(E) They are the elements required in relatively big amounts.

40. Which one of the statements in the fact that some fungi are NOT beneficial to agriculture? (A) They recycle nutrients that are linked to dead organic matter. (B) They form mycoses on plants. (C) They contribute to the initial stages of soil formation from rock. (D) They may harbor photosynthetic partners that add nitrogenous compounds to the soils. (E) None of the above.

41. Which one of pairs is matched correctly for the germ layers from which animals evolve? (A) Ectoderm-muscle. (B) Mesoderm-outer covering. (C) Endoderm-internal linings of digestive tract. (D) Mesoderm-nervous system.  (E) Ectoderm-internal linings of liver and lungs.

42. A plant with high levels of tolerance to heavy metals was applied for mining minerals in potential profitable areas. Such an application of this plant is an example of (A) bioremediation. (B) nitrogen fixation. (C) helping locate suitable sites fro toxic waste storage. (D) minimizing the erosion of soil in arid lands. (E) None of the above.

43. Why is nitrogen fixation needed for the growth of some plants? (A) Nitrogen fixers are sometimes symbiotic with legumes. (B) Nitrogen fixation can only be done by certain prokaryotes. (C) Nitrogen fixation can produce metabolic energy for plants’ growth. (D) Fixed nitrogen is a limiting factor for plant growth. (E) Nitrogen-fixing capacity is varied in many different plants.

45. How might a plant respond to cold stress EXCEPT (A) an alteration of membrane lipids. (B) the production of a specific solute “plant antifreeze” that reduces water loss. (C) excluding ice crystals from the interior walls. (D) converting of the fluid mosaic cell membrane to a solid mosaic one. (E) increasing the proportion of unsaturated fatty aid in the membranes.

46. Which one of the statements is FALSE for digestion and absorption of fat? (A) The requirement of emulsification. (B) The absorption of fat in the stomach. (C) The entrance of lymphatic system of the absorbed fat. (D) The hydrolysis of fat by lipase. (E) None of the above.

47. The function of plasma proteins is NOT related to which one of the following? (A) Oxygen transport. (B) Immune responses. (C) Transport of water-insoluble lipids. (D) Maintenance of blood osmotic pressure. (E) Blood clotting.

48. Which statement about the complement is true? (A) These proteins are involved in innate immunity only. (B) These proteins can be induced after the invasion of pathogens into the humans. (C) These proteins can only defense against the bacteria’s infection. (D) These proteins are selectively antimicrobial proteins. (E) None of the above.

49. Melatonin can participate in which one of the following items? (A) Skin pigmentation. (B) Monitoring day length. (C) Biological rhythms. (D) Reproduction. (E) All of the above.

50. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp (A) Base addition-silent. (B) Base addition-none. (C) Base addition-missense. (D) Base addition-nonsense. (E) Base addition-synonymous.