52. The pathway leading to the perception of sound begins with the hair cells of the organ of Corti,
(A) which rests on the tympanic membrane, coming in contact with the tectorial membrane.
(B) which rests on the tectorial membrane, coming in contact with the basilar membrane.
(C) which rests on the basilar membrane, coming in contact with the tectorial membrane.
(D) which comes in contact with the tectorial membrane as a result of fluid waves in the cochlea causing vibrations in the round window.
(E) which stimulates the tectorial membrane neurons leading to the auditory section of the brain.

48. Which statement about the complement is true? (A) These proteins are involved in innate immunity only. (B) These proteins can be induced after the invasion of pathogens into the humans. (C) These proteins can only defense against the bacteria’s infection. (D) These proteins are selectively antimicrobial proteins. (E) None of the above.

49. Melatonin can participate in which one of the following items? (A) Skin pigmentation. (B) Monitoring day length. (C) Biological rhythms. (D) Reproduction. (E) All of the above.

50. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp (A) Base addition-silent. (B) Base addition-none. (C) Base addition-missense. (D) Base addition-nonsense. (E) Base addition-synonymous.

51. What distinguishes a coelomate animal from a pseudocoelomate animal is that coelomates? (A) have a body cavity completely lined by mesodermal tissue, whereas pseudocoelomates do not. (B) have a complete digestive system with mouth and anus, whereas pseudocoelomates have a digestive tract with only one opening. (C) have a gut that lacks suspension within the body cavity, whereas pseudocoelomates have mesenteries that hold the digestive system in place. (D) contain tissues derived from mesoderm, whereas pseudocoelomates have no such tissue. (E) have a body cavity, whereas pseudocoelomates have a solid body.

53. A drug might act as a stimulant of the somatic nervous system if it (A) increases the sensitivity of the postsynaptic membrane to acetylcholine. (B) increases the release of substances that cause the hyperpolarization of the neurons. (C) stimulates the activity of acetylcholinesterase in the synaptic cleft. (D) makes the membrane permanently impermeable to sodium. (E) increases the sensitivity of the presynaptic membrane to acetylcholine.

54. Which of the following word pairs are MISMATCHED? (A) Random distribution: aggressive interaction. (B) Clumped distribution: attraction to a common source. (C) Regular distribution: antagonistic behaviors. (D) Large scale distribution: substantial environmental changes. (E) Small scale distribution: insignificant environmental changes.

55. Why would a scientist choose to use DNA analysis rather than isozyme analysis when investigating genetic variations? (A) Smaller sample size can be used for DNA analysis. (B) Repeat sampling over a period of time is possible. (C) Non-injurious to the organism. (D) Non-lethal. (E) All of the choices are correct.

56. Which of the following ecosystems has the highest net primary production (g/m2/yr): (A) Estuary. (B) Swamp and marsh. (C) Algal beds and reefs. (D) Tropical rain forest. (E) Temperate deciduous forest.

57. The frequency of antibiotic resistance increases in human populations which is the result of: (A) balancing selection. (B) disruptive selection. (C) directional selection. (D) sexual selection. (E) stabilizing selection.

58. Bioinformatics is the application of computational methods to the storage and analysis of enormous volumes of biological data. What is the BLAST program in NCBI which has been described by many biologists as the single most important tool in bioinformatics? (A) It is the tool to find out ESTs (expressed sequence tags). (B) It is the tool to figure out the protein-protein interaction. (C) It is the tool to translate the coding sequence. (D) It is the tool to align the sequences. (E) It is the tool to look the protein 3D structure.