54. Which of the following word pairs are MISMATCHED?
(A) Random distribution: aggressive interaction.
(B) Clumped distribution: attraction to a common source.
(C) Regular distribution: antagonistic behaviors.
(D) Large scale distribution: substantial environmental changes.
(E) Small scale distribution: insignificant environmental changes.

50. Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp (A) Base addition-silent. (B) Base addition-none. (C) Base addition-missense. (D) Base addition-nonsense. (E) Base addition-synonymous.

51. What distinguishes a coelomate animal from a pseudocoelomate animal is that coelomates? (A) have a body cavity completely lined by mesodermal tissue, whereas pseudocoelomates do not. (B) have a complete digestive system with mouth and anus, whereas pseudocoelomates have a digestive tract with only one opening. (C) have a gut that lacks suspension within the body cavity, whereas pseudocoelomates have mesenteries that hold the digestive system in place. (D) contain tissues derived from mesoderm, whereas pseudocoelomates have no such tissue. (E) have a body cavity, whereas pseudocoelomates have a solid body.

52. The pathway leading to the perception of sound begins with the hair cells of the organ of Corti, (A) which rests on the tympanic membrane, coming in contact with the tectorial membrane. (B) which rests on the tectorial membrane, coming in contact with the basilar membrane. (C) which rests on the basilar membrane, coming in contact with the tectorial membrane. (D) which comes in contact with the tectorial membrane as a result of fluid waves in the cochlea causing vibrations in the round window. (E) which stimulates the tectorial membrane neurons leading to the auditory section of the brain.

53. A drug might act as a stimulant of the somatic nervous system if it (A) increases the sensitivity of the postsynaptic membrane to acetylcholine. (B) increases the release of substances that cause the hyperpolarization of the neurons. (C) stimulates the activity of acetylcholinesterase in the synaptic cleft. (D) makes the membrane permanently impermeable to sodium. (E) increases the sensitivity of the presynaptic membrane to acetylcholine.

55. Why would a scientist choose to use DNA analysis rather than isozyme analysis when investigating genetic variations? (A) Smaller sample size can be used for DNA analysis. (B) Repeat sampling over a period of time is possible. (C) Non-injurious to the organism. (D) Non-lethal. (E) All of the choices are correct.

56. Which of the following ecosystems has the highest net primary production (g/m2/yr): (A) Estuary. (B) Swamp and marsh. (C) Algal beds and reefs. (D) Tropical rain forest. (E) Temperate deciduous forest.

57. The frequency of antibiotic resistance increases in human populations which is the result of: (A) balancing selection. (B) disruptive selection. (C) directional selection. (D) sexual selection. (E) stabilizing selection.

58. Bioinformatics is the application of computational methods to the storage and analysis of enormous volumes of biological data. What is the BLAST program in NCBI which has been described by many biologists as the single most important tool in bioinformatics? (A) It is the tool to find out ESTs (expressed sequence tags). (B) It is the tool to figure out the protein-protein interaction. (C) It is the tool to translate the coding sequence. (D) It is the tool to align the sequences. (E) It is the tool to look the protein 3D structure.

59. Which of the following enzyme(s) is/are involved in the human nucleotide excision repair of UV-induced pyrimidine dimers? 1. endonucleases 2. DNA ligase 3. DNA polymerase 4. photoreactivating enzyme (DNA photolyase) (A) 1. (B) 1 and 3. (C) 2 and 4. (D) 1, 2 and 3. (E) All of them. .

60. Which of the following statement regarding the transcription initiation and RNA Pol I is NOT true? (A) The regulatory sequences include a core element and an upstream element. (B) RNA Pol I is responsible for synthesizing tRNAs and 5S-rRNA. (C) An active Pol I initiation complex contains multi-protein complexes assembled in order. (D) RNA Pol I is responsible for synthesizing rRNA. (E) RNA Pol I itself is a multi-subunit complex.