64. Which of the following statements about RNA interference (RNAi) is FALSE?
(A) MicroRNAs (miRNAs) or short-interfering RNAs (siRNAs) interfere with the proper expression of mRNAs.
(B) Single-stranded pre-siRNA is cut by dicer and release typically 22bp RNA.
(C) Single-stranded siRNA associates with RISC protein and bind to target mRNA.
(D) High complementarity of siRNA and target mRNA result in mRNA degradation or translation inhibition.
(E) Low complementarity of siRNA and target mRNA result in mRNA degradation or translation inhibition.

60. Which of the following statements about plant hormones is FALSE? (A) Auxin (IAA) is produced by shoot apical meristems to stimulate stem elongation. (B) Cytokinins are synthesized in roots to regulate cell division. (C) Gibberellins (GA) are produced by meristems of apical buds to stimulate pollen development. (D) Ethylene can be produced by most parts of the plant to promote ripening of fruits. (E) Jasmonates are derived from cartenoid regulate floral development. Ⅱ.

複選題61. Which of the following statements about eukaryotic transcription is FALSE? (A) Transcription factors bind on the TATA box of promoters. (B) RNA polymerase II unwinds the double strand DNA and synthesis mRNAs. (C) MyoD is a transcription factor committing cells into skeletal muscle. (D) The direct binding of enhancer with the promoter increases the rate of gene expression. (E) The start point is the nucleotide where RNA synthesis actually begins. .

62. Which of the following statements about protist is FALSE? (A) Entamoeba histolytica moves by pseudopodia and causes intestinal illness. (B) Trypanosoma moves by flagella and causes sleeping sickness. (C) Plasmodium moves by cilia and causes malaria. (D) Paramecium moves by cilia and the genetic variation results from conjugation. (E) Trichomonas moves by flagella and causes sexually transmitted disease.

63. Which of the following statements is FALSE? (A) The hilum was observed in the starch grains of potato under microscope. (B) The liver cells of pig may contain more than one nucleus. (C) The shape of pigment cells in the fish scale is irregular. (D) The fat cells stained by Sudan dye turned into blue color. (E) The composition of crystals in the plants can be CaCO3 or Calcium oxalate.

65. Which of the following coding region of a mRNA can encode a peptide and end at stop codon? (A) 5’ ACGAUAAACUGAUCUAUUAG 3’ (B) 5’ CACAUAUGAAAGACACCCUAA 3’ (C) 5’ AAUAGCCAGUAGGCCGCUAG 3’ (D) 5’ ACUUAGCGAACUCCACAAUG 3’ (E) 5’ GGGACAUGCCCAGAUGACAC 3’

66. A farmer uses triazine herbicide to control pigweed in his field. For the first few years, the triazine works well and almost all the pigweed dies; but after several years, the farmer sees more and more pigweed. Which of these explanations best explains what happened? (A) The herbicide company lost its triazine formula and started selling poor-quality triazine. (B) Triazine-resistant pigweed has less-efficient photosynthesis metabolism. (C) Natural selection caused the pigweed to mutate, creating a new triazine-resistant species. (D) Triazine-resistant weeds were more likely to survive and reproduce. (E) Disruptive selection caused the pigweed to produce a new triazine-resistant species.

67. You enjoy learning about history by traveling throughout North America studying gravestones. You notice that gravestones from 1900 and earlier usually host many types of lichens. But in one cemetery, lichens are entirely absent, even from old gravestones. Given what is known about lichens, the cemetery without lichens probably ______. (A) has an unusually dry climate (B) is subject to extremely cold winter temperatures (C) gets a great deal of rain, which favors the growth of competing bacteria (D) has a high population of fungi that parasitize lichens (E) is close to a source of air pollution

68. The most immediate potential benefits of introducing genetically modified crops include ______. I. creating crops that can grow on land previously unsuitable for agriculture II. creating crops with better potential for biofuel production III. creating crops with better nutritional attributes IV. increasing crop yield V. decreasing the mutation rate of certain genes (A) III, IV, and V (B) II, III, and IV (C) I, II, and III (D) I, II, III, and IV (E) I, II, III, IV, and V

69. Radish flowers may be red, purple, or white. A cross between a red-flowered plant and a white-flowered plant yields all-purple offspring. The part of the radish we eat may be oval or long, with long being the dominant trait. If true-breeding red long radishes are crossed with true-breeding white oval radishes, the F1 will be expected to be which of the following? (A) purple and long (B) purple and oval (C) red and long (D) white and long (E) red and oval

70. What is the most logical sequence of steps for splicing foreign DNA into a plasmid and inserting the plasmid into a bacterium? I. Transform bacteria with a recombinant DNA molecule. II. Cut the plasmid DNA using restriction enzymes (endonucleases). III. Extract plasmid DNA from bacterial cells. IV. Hydrogen-bond the plasmid DNA to nonplasmid DNA fragments. V. Use ligase to seal plasmid DNA to nonplasmid DNA. (A) III, II, IV, V, I (B) IV, V, I, II, III (C) II, III, V, IV, I (D) III, IV, V, I, II (E) III, I, IV, V, II