68. The most immediate potential benefits of introducing genetically modified crops include ______. I. creating crops that can grow on land previously unsuitable for agriculture II. creating crops with better potential for biofuel production III. creating crops with better nutritional attributes IV. increasing crop yield V. decreasing the mutation rate of certain genes
(A) III, IV, and V
(B) II, III, and IV
(C) I, II, and III
(D) I, II, III, and IV
(E) I, II, III, IV, and V

64. Which of the following statements about RNA interference (RNAi) is FALSE? (A) MicroRNAs (miRNAs) or short-interfering RNAs (siRNAs) interfere with the proper expression of mRNAs. (B) Single-stranded pre-siRNA is cut by dicer and release typically 22bp RNA. (C) Single-stranded siRNA associates with RISC protein and bind to target mRNA. (D) High complementarity of siRNA and target mRNA result in mRNA degradation or translation inhibition. (E) Low complementarity of siRNA and target mRNA result in mRNA degradation or translation inhibition.

65. Which of the following coding region of a mRNA can encode a peptide and end at stop codon? (A) 5’ ACGAUAAACUGAUCUAUUAG 3’ (B) 5’ CACAUAUGAAAGACACCCUAA 3’ (C) 5’ AAUAGCCAGUAGGCCGCUAG 3’ (D) 5’ ACUUAGCGAACUCCACAAUG 3’ (E) 5’ GGGACAUGCCCAGAUGACAC 3’

66. A farmer uses triazine herbicide to control pigweed in his field. For the first few years, the triazine works well and almost all the pigweed dies; but after several years, the farmer sees more and more pigweed. Which of these explanations best explains what happened? (A) The herbicide company lost its triazine formula and started selling poor-quality triazine. (B) Triazine-resistant pigweed has less-efficient photosynthesis metabolism. (C) Natural selection caused the pigweed to mutate, creating a new triazine-resistant species. (D) Triazine-resistant weeds were more likely to survive and reproduce. (E) Disruptive selection caused the pigweed to produce a new triazine-resistant species.

67. You enjoy learning about history by traveling throughout North America studying gravestones. You notice that gravestones from 1900 and earlier usually host many types of lichens. But in one cemetery, lichens are entirely absent, even from old gravestones. Given what is known about lichens, the cemetery without lichens probably ______. (A) has an unusually dry climate (B) is subject to extremely cold winter temperatures (C) gets a great deal of rain, which favors the growth of competing bacteria (D) has a high population of fungi that parasitize lichens (E) is close to a source of air pollution

69. Radish flowers may be red, purple, or white. A cross between a red-flowered plant and a white-flowered plant yields all-purple offspring. The part of the radish we eat may be oval or long, with long being the dominant trait. If true-breeding red long radishes are crossed with true-breeding white oval radishes, the F1 will be expected to be which of the following? (A) purple and long (B) purple and oval (C) red and long (D) white and long (E) red and oval

70. What is the most logical sequence of steps for splicing foreign DNA into a plasmid and inserting the plasmid into a bacterium? I. Transform bacteria with a recombinant DNA molecule. II. Cut the plasmid DNA using restriction enzymes (endonucleases). III. Extract plasmid DNA from bacterial cells. IV. Hydrogen-bond the plasmid DNA to nonplasmid DNA fragments. V. Use ligase to seal plasmid DNA to nonplasmid DNA. (A) III, II, IV, V, I (B) IV, V, I, II, III (C) II, III, V, IV, I (D) III, IV, V, I, II (E) III, I, IV, V, II

71. The following table compares the % sequence homology of four different parts (two introns and two exons) of a gene that is found in five different eukaryotic species. The data reported for species A were obtained by comparing DNA from one member of species A to another member of species A. Which of these four gene parts should allow the construction of the most accurate phylogenetic tree, assuming that this is the only part of the gene that has acted as a reliable molecular clock? (A) Exon I (B) Exon V (C) Intron I (D) Intron VI (E) Both Exon I and V

72. The tails of UCSD campus male dark-eyed juncos were, on average, 36% white, whereas the tails of male juncos from the original colonizing population averaged 40-45% white. If this observed trait difference were due to a difference in the original colonizing population, it would most likely be due to ______. (A) a genetic bottleneck (B) a founder effect (C) gene flow between populations (D) mutations in the UCSD population (E) stabilizing selection

73. The phenomenon of fusion is likely to occur when, after a period of geographic isolation, two populations meet again and ______. (A) an increasing number of viable, fertile hybrids is produced over the course of the next one hundred generations (B) an increasing number of infertile hybrids is produced over the course of the next one hundred generations (C) no reproduction occurs in the hybrid zone (D) a decreasing number of viable, fertile hybrids is produced over the course of the next one hundred generations (E) fewer and fewer hybridization occurs

74. If two species are close competitors, and one species is experimentally removed from the community, the remaining species would be expected to ______. (A) become the target of specialized parasites (B) expand its realized niche (C) change its fundamental niche (D) decline in abundance (E) unchange